Review



human gli1  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc human gli1
    Human Gli1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+gli1/Gli1+(Plasmid+%2334996)/pm40345509-79-6-30
    Average 93 stars, based on 16 article reviews
    human gli1 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Mutagenesis:

    Article Title: WIP1 phosphatase modulates the Hedgehog signaling by enhancing GLI1 function.
    Article Snippet: After mechanical disruption, tumors were incubated in Dulbecco’s Modified Eagle Medium (DMEM)/F12 (Euroclone, Milan, Italy) and cells were grown in DMEM/F12 with 10% fetal bovine serum (FBS).14 The identity of melanoma cells was verified by immunocytochemistry, as described.51 Drugs used for treatments were puromycin (2mg/ml), CCT007093 (CCT, 10 mM), CHX (80mg/ml), tomatidine (Tom; 2.5mM) (Sigma-Aldrich, St Louis, MO, USA) and Cyc (2.5 mM, TRC, Toronto, Canada). .. Plasmids, mutagenesis and lentiviral vectors Myc-tagged human GLI1, GLI3 (kind gift from A Ruiz i Altaba)18 and GLI2 (Addgene, Cambridge, MA, USA)71 were previously described. .. WIP1 and p53 cDNAs were PCR amplified with Platinum Pfx DNA polymerase (Life Technologies, Grand Island, NY, USA) and cloned into pCAG vector (Life Technologies).

    Plasmid Preparation:

    Article Title: ASPM Activates Hedgehog and Wnt Signaling to Promote Small Cell Lung Cancer Stemness and Progression.
    Article Snippet: .. The lentivirus-mediated OE vector of human GLI1 was obtained from Addgene (pLUT7 HA-GLI1; plasmid #62970; ref. 14). .. Lentivirus was produced in Lenti-X 293T cells (Clontech/ Takara Bio) using the packaging vectors pMD2.G (Addgene #12259; RRID: Addgene_12259) and psPAX2 (Addgene #12260; RRID: Addgene_12260) to boost viral titer.

    Article Title: Acquired resistance to vemurafenib restrains thyroid cancer stem cell self-renewal by suppressing STAT3 activation.
    Article Snippet: Vemurafenib (PLX4032) is a B-Raf kinase-specific inhibitor that has been approved for treating BRAF-mutated melanoma but is ineffective in treating thyroid cancer.. Cancer stem cells (CSCs) play an important role in drug resistance (DR).. Our present study aims to determine the status of CSCs in thyroid cancer cells that have acquired adaptive drug resistance to PLX4032.

    Expressing:

    Article Title: Acquired resistance to vemurafenib restrains thyroid cancer stem cell self-renewal by suppressing STAT3 activation.
    Article Snippet: Vemurafenib (PLX4032) is a B-Raf kinase-specific inhibitor that has been approved for treating BRAF-mutated melanoma but is ineffective in treating thyroid cancer.. Cancer stem cells (CSCs) play an important role in drug resistance (DR).. Our present study aims to determine the status of CSCs in thyroid cancer cells that have acquired adaptive drug resistance to PLX4032.



    Similar Products

    94
    Shanghai Korain Biotech Co Ltd bt lab e6417hu e5411hu
    Bt Lab E6417hu E5411hu, supplied by Shanghai Korain Biotech Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+gli1/Human+Zinc+Finger+Protein+Gli1/pmc12044452-84-13-13
    Average 94 stars, based on 1 article reviews
    bt lab e6417hu e5411hu - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    R&D Systems gli1
    Gli1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+gli1/Human%2FMouse+GLI-1+Antibody/pm41857757-52-25-29
    Average 93 stars, based on 1 article reviews
    gli1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    R&D Systems anti gli1 antibody
    Anti Gli1 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+gli1/Human+GLI-1+Antibody/pm41219186-290-5-7
    Average 93 stars, based on 1 article reviews
    anti gli1 antibody - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    R&D Systems antibodies against gli1
    Antibodies Against Gli1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+gli1/Human+GLI-1+Antibody/pm41071877-419-7-13
    Average 93 stars, based on 1 article reviews
    antibodies against gli1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc human gli1
    Human Gli1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+gli1/Gli1+(Plasmid+%2334996)/pm40345509-79-6-30
    Average 93 stars, based on 1 article reviews
    human gli1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    OriGene agccttcagcaatgccagtgac origene
    Agccttcagcaatgccagtgac Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+gli1/GLI1+Human+qPCR+Primer+Pair/pm39903667-184-69-70
    Average 93 stars, based on 1 article reviews
    agccttcagcaatgccagtgac origene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results